Oncotarget

This article has been retracted. Retraction in: Oncotarget. 2022; 13:863-863.

Research Papers:

MicroRNA-218 inhibits proliferation and invasion in ovarian cancer by targeting Runx2

PDF  |  Full Text  |  How to cite

Oncotarget. 2017; 8:91530-91541. https://doi.org/10.18632/oncotarget.21069

Metrics: PDF 2602 views  |  Full Text 4072 views

Na Li1, Lufei Wang2, Guangyun Tan3, Zhiheng Guo1, Lei Liu1, Ming Yang4,* and Jin He1,*

1Department of Gynecology and Obstetrics, The First Hospital of Jilin University, Changchun, Jilin 130021, PR China

2Department of Ophthalmology, The Second Hospital of Jilin University, Changchun, Jilin 130022, PR China

3Department of Immunology, Institute of Translational Medicine of The First Hospital of Jilin University, Changchun, Jilin 130021, PR China

4Department of Breast Surgery, The First Hospital of Jilin University, Changchun, Jilin 130021, PR China

*These authors have contributed equally to this work

Correspondence to:

Ming Yang, email: [email protected]

Jin He, email: [email protected]

Keywords: MiR-218, ovarian cancer, RUNX2, proliferation, invasion

Received: April 07, 2017     Accepted: July 19, 2017     Published: September 16, 2017

ABSTRACT

MicroRNA-218 (miR-218) has been implicated in the development and progression of multiple cancers. We investigated the role of miR-218 in ovarian cancer progression. We found that miR-218 expression levels were lower in ovarian cancer tissues and cell lines than in adjacent normal tissues or a normal ovarian cell line.miR-218 levels associated with International Federation of Gynecology and Obstetrics (FIGO) stage and lymph node metastasis. Exogenous expression of miR-218 inhibited cell proliferation, colony formation, migration, and invasion in vitro and suppressed tumor growth in a tumor-bearing nude mouse model. Runt-related transcription factor 2 (RUNX2) was identified as a direct functional target of miR-218, and its expression was inversely correlated with miR-218 expression in ovarian cancer tissues. RUNX2 overexpression rescued the suppressive effect of miR-218 on ovarian cancer cell proliferation, colony formation, migration, and invasion. These findings highlight an important role played bymiR-218 in the regulation of cancer growth and metastasis, in part by repressing RUNX2, and revealed the potential of miR-218 as a new therapeutic target inovarian cancer.

INTRODUCTION

Ovarian cancer is the leading cause of death from gynecological malignancies [1].Unfortunately, treatments, which include extensive surgery, radiotherapy, chemotherapy, or concurrent chemo/radiation, are not effective for patients with advanced ovarian cancer mainly due to tumor recurrence, metastasis, or poor response to chemo/radiotherapy [2, 3]. Thus, development of new therapy target for ovarian cancer treatment is still urgently needed.

MicroRNAs (miRNAs), a class of short non-coding RNAs, are involved in the regulation of a variety of biological processes, such as cell proliferation, cell cycle, cell migration and invasion, glucose and lipid metabolism, signal transduction, and response to external stimuli [4, 5]. miRNAs are aberrantly expressed in various types of cancer and play crucial roles in cancer initiation, development, and metastasis by regulating cancer-relatedtarget genes [6, 7]. Recently, many miRNAs have been implicated in ovarian cancer progression, serving as oncogenes or tumor suppressors [8, 9].

miR-218 is significantly downregulated in colorectal [10], gastric [11], non-small cell lung [12], breast [13], colon [14], liver [15], and nasopharyngeal cancer [16], supporting miR-218 as a tumor suppressor in these types of cancers. In the present study, we sought to clarify the role of miR-218 in ovarian cancer by using in vitro and in vivo assays and analysis of clinical ovarian cancer tissue samples.

RESULTS

MiR-218 is downregulated in ovarian cancer tissues and cell lines

We first investigated the expression of miR-218 in four ovarian cancer cell lines (SW626, A2780, SKOV3, OVCAR3) and human ovarian surface epithelial (HOSE) cells. We found that miR-218 expression was downregulated in all four ovarian cancer cell lines compared to the levels noted in thenormal ovarian cell line (Figure 1A). SKOV3 cells possessed the lowest miR-218 expression (Figure 1A) and were therefore selected for subsequent studies. We examined miR-218 expression in 48 pairs of ovarian cancer tissues and adjacent normal tissues, and found that miR-218 expression was significantly downregulated in ovarian cancer tissues compared with adjacent normal tissues (Figure 1B). To further investigate the clinicopathological significance of miR-218 level in patients with ovarian cancer, 48 patients were divided into 2 subgroups based on mean level of miR-218 expression (0.297) of all samples: a low miR-218 group (<0.297, 27 cases) and a high miR-218 group (>0.297, 21 cases). Further statistical analysis demonstrated that lower levels of miR-218 were significantly associated with the malignant progression of ovarian cancer, including lymph nodal metastasis, FIGO stage, and histological grading (all p<0.01, Table 1).

Figure 1: miR-218 expression was downregulated in ovarian cancer cell lines and tissues. (A) The relative expression level of miR-218 was measured by qPCR in four ovarian cell lines (SW626, A2780, SKOV3, OVCAR3) and HOSE cells.U6 was used for normalization. (B) The relative expression level of miR-218 was detected by qPCR in 48 pairs of ovarian cancer tissues and adjacent normal tissues.U6 was used for normalization.*Indicates significant difference at p<0.05; **Indicates significant difference at p<0.01.

Table 1: Association between miR-218 expression and clinicopathological features of human ovarian cancer

Variables

No. of cases

miR-218 expression

p-value

Low (n %)

High (n %)

Age(years)

p>0.05

 <50

23

13(56.5)

10(43.5)

 ≥50

25

14(56.0)

11(44.0)

Gender

p>0.05

 Male

19

10(52.6)

9(47.4)

 Female

29

17(58.6)

12(41.4)

TNM stage

p<0.01

 I-II

31

12(38.7)

19(61.3)

 III-IV

17

15(88.2)

2(11.8)

Tumor size

p>0.05

 <5 cm

30

18(60.0)

12(40.0)

 ≥5 cm

18

9(50.0)

9(50.0)

Lymph node metastasis

p<0.01

 No

33

13(39.4)

20(60.6)

 Yes

15

14(93.3)

1(6.7)

MiR-218 inhibits cell growth, invasion, and migration in vitro

To explore the possible biological functions of miR-218 in ovarian cancer cells, SKOV3 cells were transfected with miR-218 mimic or miR-NC, and then cell proliferation, colony formation, migration, and invasion were evaluated. qPCR showed that miR-218 expression was significantly increased in cells transfected with miR-218 mimic compared with cells transfected with miR-NC (Figure 2A).CCK8 assays demonstrated that cell proliferation was significantly inhibited by miR-218 overexpression in a time-dependent manner (Figure 2B). Consistent with this result, miR-218 overexpression obviously inhibited colony formation in ovarian cancer cells (Figure 2C). Wound healing and transwell invasion assays were performed to measure the migration and invasion ability of ovarian cancer cells after modification of miR-218 expression. We found thatmiR-218 overexpression significantly suppressed cell migration and invasion ability of ovarian cancer cells (Figure 2D and 2E).

Figure 2: MiR-218 inhibits cell proliferation, colony formation, migration, and invasion of ovarian cancer cells. (A) The relative expression level of miR-218 was determined by qPCR in SKOV3 cells transfected with miR-218 mimic or miR-NC. U6 was used for normalization. (B-E) Cell proliferation, colony formation, migration, and invasion were determined by qPCR in SKOV3 cells transfected with miR-218 mimic or miR-NC. *Indicates significant difference at p<0.05; **Indicates significant difference at p<0.01.

RUNX2 is a target of miR-218 in ovarian cancer cells

We identified the potential targets of miR-218using a publicly available algorithm TargetScan and found a conserved miR-218 binding site in the 3’-UTR of RUNX2 mRNA (Figure 3A). We then used a dual luciferase reporter system to test the effect of miR-218 on RUNX2. As shown in Figure 4B, miR-218 dramatically inhibited the luciferase activity of the wild-type (WT) RUNX2- 3’UTR but not that of the mutant (MT) 3’ UTR (Figure 3B). To further demonstrate the effect of miR-218 on RUNX2 expression, we examined the expression of RUNX2 in SKOV3 cells transfected with miR-218 mimic or miR-NC by qPCR or Western blot, respectively. We found that miR-218 overexpressionclearlyinhibited RUNX2 expression on the mRNA and protein levels (Figure 3C and 3D). These results demonstrate that RUNX2might be a direct target of miR-218 in ovarian cancer.

Figure 3: MiR-218 targets RUNX2 in ovarian cancer cells. (A) The miR-218 binding site predicted in the 3′-UTR regions of RUNX2 mRNAs. Mutant constructs were generated at the seed regions of RUNX2 3′-UTRs as indicated by the underlined sequence. (B) Luciferase activities were determined in SKOV3 cells cotransfected with wild-type or mutant RUNX2-3′-UTR reporter plasmid and miR-NC or miR-218 mimic. (C, D) The RUNX2 expression both on the mRNA and protein level was determined in SKOV3 cells transfected with miR-218 mimic or miR-NC by qPCR and Western blot, respectively. GAPDH was used for internal control. *Indicates significant difference at p<0.05; **Indicates significant difference at p<0.01.

Figure 4: RUNX2 expressionis upregulated and inversely correlated with miR-218 expression in ovarian cancer tissues. (A) RUNX2 mRNA expression levels were detected by qPCR in 48 pairs of ovarian cancer tissues and adjacent normal tissues. GAPDH was used as an internal control. (B) Spearman’s correlation analysis was used to determine the correlations between the expression levels of RUNX2 and miR-218 in human ovarian cancer tissues(n=48). (C, D) The RUNX2 expression both on the mRNA and protein level was determined in four ovarian cell lines (SW626, A2780, SKOV3, OVCAR3) and HOSE cells. GAPDH was used as an internal control. *Indicates significant difference at p<0.05; **Indicates significant difference at p<0.01.

Inverse correlation between RUNX2 and miR-218 expression in ovarian cancer

To explore the possible clinical relevance of RUNX2, we investigated the expression levels of runx2 in human ovarian tissues. qPCR analysis showed that RUNX2 mRNA expression was significantly upregulated in ovarian cancer tissues compared to the adjacent normal tissues(Figure 4A). Next, we further analyzed the correlation between RUNX2 mRNA levels and miR-218 expression levels in the same human ovarian cancer specimens using Spearman’s rank correlation analysis. As indicated in Figure 4B, RUNX2 mRNA expression levels in ovarian cancer tissues were inversely correlated with miR-218 expression levels (r = -0.566; p= 0.002). We also found that RUNX2 expression was increased in four ovarian cancer cell lines compared to the normal cell line both on the mRNA and protein levels (Figure 4C and 4D).

Restoration of RUNX2 reverses miR-218-suppressed cell proliferation, colony formation, migration, and invasion

To clarify whether RUNX2 was involved in the miR-218-mediated tumor suppressive effects in ovarian cancer cells, we performed a restoration experiment by co-transfecting RUNX2 and miR-218 mimic into ovarian cancer cells. As shown in Figure 5A, RUNX2 overexpression rescued miR-218-suppressed RUNX2 protein level in SKOV3 cells. Importantly, RUNX2 overexpression also restored miR-218-inhibited cell proliferation, colony formation, migration, and invasion of ovarian cancer cells (Figure 5B5E).

Figure 5: Restoration of RUNX2 reverses miR-218-suppressed cell proliferation, colony formation, migration, and invasion of ovarian cancer cells. (A) RUNX2 protein level was determined in SKOV3 cells transfected with miR-218 mimic or miR-NC with or without RUNX2 overexpression plasmid. GAPDH was used as an internal control. (B-E) Cell proliferation, colony formation, migration, and invasion were determined inSKOV3 cells transfected with miR-218 mimic or miR-NC with or without RUNX2 overexpression plasmid. *Indicates significant difference at p<0.05; **Indicates significant difference at p<0.01.

miR-218 suppresses ovarian cancer tumorigenicity in vivo by targeting RUNX2

SKOV3 cells stably expressing miR-218 or miR-NC were subcutaneously inoculated into nude mice, and tumor sizes were measured 5 days after injection. Compared with the miR-218 group, the miR-NC group developed significantly larger tumors starting from days 15 to 30 (Figure 6A). At the end of the treatment, mice were killed and tumor tissues were dissected and weighed. A significant decrease in tumor size and weight were observed in the miR-218 group compared with the miR-NC group (Figure 6B and 6C). Consistent with in vitro data, the miR-218 level in tumor tissues from the miR-218 group were much higher than those of the miR-NC group (Figure 6D), whereas RUNX2 protein expression was decreased in the miR-218 group compared to the miR-NC group (Figure 6E).

Figure 6: miR-218 suppresses ovarian cancer growth in vivo by repressing RUNX2. (A) Growth curves for tumor volumes in xenografts of nude mice from the miR-218 and miR-NC groups. (B) Representative images of tumors from the miR-218 and miR-NC groups. (C) Weights of tumors from the miR-218 and miR-NC groups. (D) The relative expression level of miR-218 was determined in tumor tissues from the miR-218 and miR-NC groups. U6 was used as an internal control. (E) RUNX2 protein expression level was determined in tumor tissues from the miR-218 and miR-NC groups by Western blot. GAPDH was used as the internal control.*Indicates significant difference at p<0.05; **Indicates significant difference at p<0.01.

DISCUSSION

miRNAs have been shown to be involved in ovarian cancer progression and carcinogenesis through regulating the expression of a variety of cancer-related genes [8, 9, 17]. In this study, we observed that miR-218 was frequently downregulated in human ovarian cancer samples and cell lines, which was inconsistent with a previous report that miR-218 was upregulated in tumor tissues from ovarian cancer-bearing mice [18]. However, the results of this previous study were not verified in human ovarian cancer tissues. Our results also demonstrate that low miR-218 expression was significantly associated with poor prognostic clinicopathological parameters, such as high histological grading, advanced FIGO stage (III/IV), and lymph node metastasis. Overexpression of miR-218 suppressed ovarian cancer cell proliferation, migration, and invasion in vitro and inhibited tumor growth in vivo. We identified and confirmed RUNX2 as a direct and functional target of miR-218 in ovarian cancer.

miR-218 is significantly downregulated, and functions as tumor suppressor in multiple cancers [10-16, 19, 20]. However, the biological function of miR-218 in ovarian cancer remains largely unclear. We found that miR-218 expression was downregulated in ovarian cancer tissues and cell lines, and that overexpression of miR-218 impaired proliferation, colony formation, invasion and migration, as well as suppressed tumor growth in bearing nude mice models. These results indicate that miR-218 has a tumor-suppressive role in ovarian cancer.

miRNAs exert their biological function through regulating specific target genes [4, 5]. To explore the mechanisms underlying miR-218 inhibition of ovarian cancer progression, we searched for potential targets of miR-218 in ovarian cancer cells using the computational algorithmTargetscan7.1. Among the candidate target genes, we focused on runt-related transcription factor 2 (Runx2) an oncogene, which was reportedly overexpressed in ovarian cancer tissues [21], as a potential target of miR-218. We demonstrated that miR-218 negatively regulates RUNX2 by binding to a specific target site within the 3’-UTR of RUNX2 by a luciferase reporter assay. Overexpression of miR-218 in human SKOV3 cells significantly inhibited RUNX2 expression at both the mRNA and protein levels. These studies suggest that RUNX2 is a target gene in ovarian cancer, which is in accordance with previous studies that demonstratedmiR-218 targets RUNX2 in non-small cell lung cancer [22] and human dental stem cells [23].

RUNX2, a member of runtrelated transcription factors (RUNX), is a major transcription factor that regulates osteoblast differentiation, chondrocyte proliferation, and differentiation in the endochondral bone formation process [24].Runx2 has been shown to be involved in tumor occurrence, development, and metastasis in several types of cancers, such as breast [25], lung [26], prostate [27], and thyroid cancer [28].RUNX2 expression was increased in ovarian cancer tissues and its upregulation was closely related with the clinical stage and poor prognosis of patients with ovarian cancer [21]. In addition, downregulation of RUNX2 expression significantly inhibited cell proliferation, migration, and invasion of ovarian cancer cells [29].Specifically, RUNX2 has been reported to be regulated in ovarian cancer by miR-338-3p [30] and miR-23b [31]. These findings indicate that RUNX2 is an ovarian cancer oncogene. Consistent with previous results, our results show that RUNX2 expression is increased in ovarian cancer tissues and cell lines. RUNX2 expression was inversely correlated with miR-218 expression in ovarian cancer tissues. RUNX2 overexpression rescued the suppressive effect of miR-218 on ovarian cancer cell proliferation, colony formation, migration, and invasion. These results suggest that miR-218 suppresses ovarian cancer, at least in part, by repressing RUNX2.

Due to our limited number of ovarian cancer samples and cell types, more elaborate studies will be necessary for further exploration of the potential role of miR-218 in ovarian cancer progression. However, our study provides the first evidence that miR-218 expression is downregulated in ovarian cancer tissues and cell lines, and its expression level is significantly negatively associated with poor prognostic clinicopathological parameters. This work is the first to indicate that miR-218 plays a suppressive role in ovarian cancer tumorigenesis and progression by inhibiting cell proliferation, colony formation, migration, and invasion by targeting RUNX2. These data indicate that miR-218 might serve as a promising new therapeutic target and prognostic indicator for ovarian cancer.

MATERIALS AND METHODS

Patients and clinical tissue specimens

Paired samples of primary ovarian tissues and adjacent normal tissues were obtained from 48 patients undergoing surgery at the First Hospital of Jilin University(Changchun, China). The collection and use of patient samples was approved by the Ethics Committee of the First Hospital of Jilin University, and written informed consent was obtained from each patient prior to surgery. All samples were immediately snap-frozen in liquid nitrogen and stored at −80°C until use. The relevant clinical characteristics of patients were recorded and are shown in Table 1.

Cell culture and transfection

Human ovarian cancer cell lines(SW626, A2780, SKOV3, OVCAR3) and HOSE cells were purchased from ATCC (Manassas, VA, USA) and cultured in Dulbecco’s modified Eagle’s medium (DMEM; HyClone, Logan, UT, USA), supplemented with 10% fetal bovine serum(FBS; HyClone) and antibiotics (100 units/ml penicillin and 100 mg/ml streptomycin) at 37°C in a humidified atmosphere of 5% CO2 in air. miR-218 mimic(UGUACCAAUCUAGUUCGUGUU) or negative control mimic (miR-NC, UCACAACCUCCUAGAAAGA GUAGA) were purchased from GenePharma (Shanghai, China). RUNX2 restoration vector (pCDNA3.1-RUNX2) was constructed by introducing the RUNX2 gene (without 3’UTR) into the pCDNA3.1 vector (GenePharma, China). These molecular products were transfected into SKOV3 cells after cells were grown to 80-90% confluence using oligofectamine-2000 (Invitrogen, Carlsbad, CA, USA) following the manufacturer’s instructions.

Real-time PCR analysis

Total RNA was extracted from tissues or cultured cells using Trizol reagent (Invitrogen) in accordance with the manufacturer’s instructions. For miRNA expression analysis, total RNA was reverse transcribed using a TaqMan MicroRNA Reverse Transcription kit (Applied Biosystems, Shanghai, China).miR-218 expression was quantified by qPCR using TaqMan Universal PCR Master Mix (Applied Biosystems) using primers for miR-218 or U6 (Applied Biosystems). U6 was used for internal control. For RUNX2 mRNA expression analysis, total RNA was converted into cDNA using Prime Script 1st Strand cDNA Synthesis Kit (TaKaRa, Dalian, China) according to the manufacturer’s protocol. RUNX2 mRNA expression levels were determined by qPCR using SYBR Green Universal PCR Master Mix (Applied Biosystems). The primers for RUNX2 and GAPDH used in this study were described previously [22].RUNX2 primers were:5′-CCGCCTCAGTGATTTAGGGC-3′ (sense) and 5′-GGGTCTGTAATCTGACTCTGTCC-3′(anti-sense); GAPDH primers were 5′-ACAACTTTGGTATCGTGGAAGG-3′(sense) and 5′-GCCATCACGCCACAGTTTC-3′(anti-sense). GAPDH was used as an endogenous control for RUNX2 mRNA normalization. Relative miR-218 and RUNX2 mRNA expression was quantified with cycle threshold (Ct) values and normalized using the 2–ΔΔCt method to U6 and GAPDH levels, respectively. All assays were performed in triplicate. The expression levels were relative to the fold change of the corresponding controls (miR-NC), which were defined as 1.0.

CCK8 assay

Ovarian cancer cell proliferation was evaluated by means of the Cell Counting Kit-8 assay (CCK-8; Dojindo, Kumamoto, Japan) in accordance to manufacturer’s instructions. The optical density (OD) was measured at 450 nm using a microplate reader (BioTek, USA).

Colony formation assay

Transfected cells were harvested and seeded into 6-well plates at a density of 1000 cells/well, and grown in DMEM containing 10% FBS for 10 days. Colonies were fixed with methanol for 15 min and stained with 0.1% crystal violet for 10 min. Colonies with >50 cells/colony were counted and photographed using a light microscope(Olympus, Tokyo, Japan). The percentage of colony formation was calculated by setting the control to 100%.

Cell migration assay

Wound healing assay was used to determine cell migration capability. SKOV3 cells were seeded in 12-well plates and grown to 100% confluence. Cells were scraped with pipette tips and washed with PBS. Cell movement into the wound area was monitored and photographed at 24 h using a light microscope (Olympus).

Cell invasion assay

Cell invasion assay was performed using Transwell invasion chambers (Corning, Tewksbury, MA, USA). Briefly, 2x104 transfected cells were seeded in the upper chambers which were coated with Matrigel (BD Biosciences, Franklin Lakes, NJ, USA). The lower chamber was filled with medium containing 10% FBS. After 48h of incubation, non-invading cells were removed with a cotton swab, while cells that had migrated to the bottom surface were fixed with 70% ethanol, stained with 0.1% crystal violet, and photographed under a light microscope. Cells were counted in five randomly selected fields using Image J software (National Institutes of Health, Bethesda, MD, USA).

Bioinformatic prediction and dual luciferase reporter assay

TargetScan7.1 (www.targetscan.org) was used to predict the putative target genes of miR-218. The 3′-untranslated region (3'-UTR) of RUNX2, containing predicted miR-218 binding sites, was amplified from human ovarian cDNA by PCR and subcloned into the pGL3 dual-luciferase expression vector (Promega, Madison, WI, USA). Mutant 3′-UTR was obtained by overlap-extension PCR. SKOV3 cells were cotransfected with wild-type or mutant RUNX2 3’ UTR reported plasmid and miR-218 mimic or miR-NC using Lipofectamine 2000 per the manufacturer’s recommendation. After 48 h of transfection, luciferase activity was determinedusing a dual-luciferase reporter assay system (Promega). Results are presented as the ratio of Renilla luciferase activity to firefly luciferase activity.

Western blotting

Total protein was extracted from cultured cells or tissues using RIPA lysis buffer (Beyotime, Jiangsu, China), and protein concentrations were measured with the bicinchoninic acid method (BCA, Pierce, Rockford, IL, USA). Equal amounts of protein (30 μg) were separated by 10% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to nitrocellulose membranes (Amersham Bioscience, USA). Membranes were incubated with primary antibody against RUNX2 and GAPDH (both from Santa Cruz Biotechnology, California, USA) at 1:1000 dilution, followed by horseradish peroxidase-labeled secondary antibody (Santa Cruz Biotechnology) at 1:5000 dilution. The protein signal bands were detected using an enhanced chemiluminescence detection reagent (ECL; Thermo Scientific, Rockford, IL, USA).

Immunohistochemistry

Immunohistochemistry was performed in tumor tissues using the streptavidin-peroxidase (SP) method (Ultra Sensitive TM-SP) as described previously [32]. Scores were independently performed by two pathologists blinded to the identity of the tissue specimens as described [33]. The RUNX2 positive cells were photographed with Inverted Research Microscope (Olympus).

In vivo tumorigenesis assay

For in vivo tumorigenesis assays, stable SKOV3 cells with high expression of miR-218 were established by transfecting SKOV3 cells with a miR-218 mimic. 2 × 106SKOV3 cells stable expressing miR-218 or miR-NC were subcutaneously injected into the flanks of female BALB/c-nude mice (18-22g, 6–7 weeks of age). Tumor size was determined by measuring tumor length (L) and width (W) using aVernier caliper every five days until mice were sacrificed. Tumor volume (mm3) was calculated using the formula: (V)= 1/2 × (L × W2). At 35 days after injection, mice were sacrificed and subcutaneous tumor tissues were dissected and weighed. All animal handling and research protocols were approved by the Animal Care and Use Ethics Committee of the First of Hospital of Jilin University (Changchun, China).

Statistical analysis

All data are presented as the mean ± standard deviation (SD) from at least three independent experiments. Student’s t test was used to analyze differences between two groups. One-way ANOVA was used to analyze differences between three or more groups. SPSS 19.0 software (SPSS, Inc., Chicago, IL, USA) was used for statistical analysis. P values<0.05 were considered statistically significant.

FINANCIAL SUPPORT

This work was supported by the Project of Health and Family Planning Commission of Jilin(2010Z100).

CONFLICTS OF INTEREST

The authors declare that they have no conflicts of interest.

REFERENCES

1. Siegel R, Naishadham D, Jemal A. Cancer statistics, 2013. CA Cancer J Clin. 2013; 63: 11-30. https://doi.org/10.3322/caac.21166.

2. Permuth-Wey J, Sellers TA. Epidemiology of ovarian cancer. Methods Mol Biol. 2009; 472: 413-37. https://doi.org/10.1007/978-1-60327-492-0_20.

3. Lengyel E. Ovarian cancer development and metastasis. Am J Pathol. 2010; 177: 1053-64. https://doi.org/10.2353/ajpath.2010.100105.

4. Lim LP, Lau NC, Garrett-Engele P, Grimson A, Schelter JM, Castle J, Bartel DP, Linsley PS, Johnson JM. Microarray analysis shows that some microRNAs downregulate large numbers of target mRNAs. Nature. 2005; 433: 769-73. https://doi.org/10.1038/nature03315.

5. Ambs S, Prueitt RL, Yi M, Hudson RS, Howe TM, Petrocca F, Wallace TA, Liu CG, Volinia S, Calin GA, Yfantis HG, Stephens RM, Croce CM. Genomic profiling of microRNA and messenger RNA reveals deregulated microRNA expression in prostate cancer. Cancer Res. 2008; 68: 6162-70. https://doi.org/10.1158/0008-5472.CAN-08-0144.

6. Hobert O. Gene regulation by transcription factors and microRNAs. Science. 2008; 319: 1785-6. https://doi.org/10.1126/science.1151651.

7. Iorio MV, Croce CM. MicroRNAs in cancer: small molecules with a huge impact. J Clin Oncol. 2009; 27: 5848-56. https://doi.org/10.1200/JCO.2009.24.0317.

8. Kinose Y, Sawada K, Nakamura K, Kimura T. The role of microRNAs in ovarian cancer. Biomed Res Int. 2014; 2014: 249393. https://doi.org/10.1155/2014/249393.

9. Wang Y, Kim S, Kim IM. Regulation of Metastasis by microRNAs in Ovarian Cancer. Front Oncol. 2014; 4: 143. https://doi.org/10.3389/fonc.2014.00143.

10. Yu H, Gao G, Jiang L, Guo L, Lin M, Jiao X, Jia W, Huang J. Decreased expression of miR-218 is associated with poor prognosis in patients with colorectal cancer. Int J Clin Exp Pathol. 2013; 6: 2904-11.

11. Xiangyuan Z, Jiaqiang D, Yan H, Ming Z, Zhen L, Na W, Mingzuo J, Zhe Z, Gang L, Haiming L, Yongzhan N, Daiming F, Jun T. miR-218 inhibited tumor angiogenesis by targeting ROBO1 in gastric cancer. Gene. 2017. https://doi.org/10.1016/j.gene.2017.03.022.

12. Shi ZM, Wang L, Shen H, Jiang CF, Ge X, Li DM, Wen YY, Sun HR, Pan MH, Li W, Shu YQ, Liu LZ, Peiper SC, et al. Downregulation of miR-218 contributes to epithelial-mesenchymal transition and tumor metastasis in lung cancer by targeting Slug/ZEB2 signaling. Oncogene. 2017. https://doi.org/10.1038/onc.2016.414.

13. Liu B, Tian Y, Li F, Zhao Z, Jiang X, Zhai C, Han X, Zhang L. Tumor-suppressing roles of miR-214 and miR-218 in breast cancer. Oncol Rep. 2016; 35: 3178-84. https://doi.org/10.3892/or.2016.4749.

14. Zhang X, Shi H, Tang H, Fang Z, Wang J, Cui S. miR-218 inhibits the invasion and migration of colon cancer cells by targeting the PI3K/Akt/mTOR signaling pathway. Int J Mol Med. 2015; 35: 1301-8. https://doi.org/10.3892/ijmm.2015.2126.

15. Fu WM, Tang LP, Zhu X, Lu YF, Zhang YL, Lee WY, Wang H, Yu Y, Liang WC, Ko CH, Xu HX, Kung HF, Zhang JF. MiR-218-targeting-Bmi-1 mediates the suppressive effect of 1,6,7-trihydroxyxanthone on liver cancer cells. Apoptosis. 2015; 20: 75-82. https://doi.org/10.1007/s10495-014-1047-3.

16. Alajez NM, Lenarduzzi M, Ito E, Hui AB, Shi W, Bruce J, Yue S, Huang SH, Xu W, Waldron J, O'Sullivan B, Liu FF. MiR-218 suppresses nasopharyngeal cancer progression through downregulation of survivin and the SLIT2-ROBO1 pathway. Cancer Res. 2011; 71: 2381-91. https://doi.org/10.1158/0008-5472.CAN-10-2754.

17. Nagaraj AB, Joseph P, DiFeo A. miRNAs as prognostic and therapeutic tools in epithelial ovarian cancer. Biomark Med. 2015; 9: 241-57. https://doi.org/10.2217/bmm.14.108.

18. Liu Y, Lin X, Bao T, Ni P, Xie C, Shen H, Xu W, Xu H, Su Z. Detection and correlation analysis of miRNAs and myeloid-derived suppressor cells in ovarian cancer-bearing mice. [Article in Chinese]. Xi Bao Yu Fen Zi Mian Yi Xue Za Zhi. 2015; 31: 467-9, 73.

19. Li J, Ping Z, Ning H. MiR-218 impairs tumor growth and increases chemo-sensitivity to cisplatin in cervical cancer. Int J Mol Sci. 2012; 13: 16053-64. https://doi.org/10.3390/ijms131216053.

20. Guan H, Wei G, Wu J, Fang D, Liao Z, Xiao H, Li M, Li Y. Down-regulation of miR-218-2 and its host gene SLIT3 cooperate to promote invasion and progression of thyroid cancer. J Clin Endocrinol Metab. 2013; 98: E1334-44. https://doi.org/10.1210/jc.2013-1053.

21. Li W, Xu S, Lin S, Zhao W. Overexpression of runt-related transcription factor-2 is associated with advanced tumor progression and poor prognosis in epithelial ovarian cancer. J Biomed Biotechnol. 2012; 2012: 456534. https://doi.org/10.1155/2012/456534.

22. Xie J, Yu F, Li D, Zhu X, Zhang X, Lv Z. MicroRNA-218 regulates cisplatin (DPP) chemosensitivity in non-small cell lung cancer by targeting RUNX2. Tumour Biol. 2016; 37: 1197-204. https://doi.org/10.1007/s13277-015-3831-2.

23. Gay I, Cavender A, Peto D, Sun Z, Speer A, Cao H, Amendt BA. Differentiation of human dental stem cells reveals a role for microRNA-218. J Periodontal Res. 2014; 49: 110-20. https://doi.org/10.1111/jre.12086.

24. Vishal M, Ajeetha R, Keerthana R, Selvamurugan N. Regulation of Runx2 by Histone Deacetylases in Bone. Curr Protein Pept Sci. 2016; 17: 343-51.

25. Onodera Y, Miki Y, Suzuki T, Takagi K, Akahira J, Sakyu T, Watanabe M, Inoue S, Ishida T, Ohuchi N, Sasano H. Runx2 in human breast carcinoma: its potential roles in cancer progression. Cancer Sci. 2010; 101: 2670-5. https://doi.org/10.1111/j.1349-7006.2010.01742.x.

26. Li H, Zhou RJ, Zhang GQ, Xu JP. Clinical significance of RUNX2 expression in patients with nonsmall cell lung cancer: a 5-year follow-up study. Tumour Biol. 2013; 34: 1807-12. https://doi.org/10.1007/s13277-013-0720-4.

27. Brubaker KD, Vessella RL, Brown LG, Corey E. Prostate cancer expression of runt-domain transcription factor Runx2, a key regulator of osteoblast differentiation and function. Prostate. 2003; 56: 13-22. https://doi.org/10.1002/pros.10233.

28. Niu DF, Kondo T, Nakazawa T, Oishi N, Kawasaki T, Mochizuki K, Yamane T, Katoh R. Transcription factor Runx2 is a regulator of epithelial-mesenchymal transition and invasion in thyroid carcinomas. Lab Invest. 2012; 92: 1181-90. https://doi.org/10.1038/labinvest.2012.84.

29. Wang ZQ, Keita M, Bachvarova M, Gobeil S, Morin C, Plante M, Gregoire J, Renaud MC, Sebastianelli A, Trinh XB, Bachvarov D. Inhibition of RUNX2 transcriptional activity blocks the proliferation, migration and invasion of epithelial ovarian carcinoma cells. PLoS One. 2013; 8: e74384. https://doi.org/10.1371/journal.pone.0074384.

30. Wen C, Liu X, Ma H, Zhang W, Li H. miR3383p suppresses tumor growth of ovarian epithelial carcinoma by targeting Runx2. Int J Oncol. 2015; 46: 2277-85. https://doi.org/10.3892/ijo.2015.2929.

31. Li W, Liu Z, Chen L, Zhou L, Yao Y. MicroRNA-23b is an independent prognostic marker and suppresses ovarian cancer progression by targeting runt-related transcription factor-2. FEBS Lett. 2014; 588: 1608-15. https://doi.org/10.1016/j.febslet.2014.02.055.

32. Wang P, Meng X, Huang Y, Lv Z, Liu J, Wang G, Meng W, Xue S, Zhang Q, Zhang P, Chen G. MicroRNA-497 inhibits thyroid cancer tumor growth and invasion by suppressing BDNF. Oncotarget. 2017; 8: 2825-34. https://doi.org/10.18632/oncotarget.13747.

33. Zhang W, Liu S, Liu K, Wang Y, Ji B, Zhang X, Liu Y. A disintegrin and metalloprotease (ADAM) 10 is highly expressed in hepatocellular carcinoma and is associated with tumour progression. J Int Med Res. 2014; 42: 611-8. https://doi.org/10.1177/0300060513505500.