Oncotarget

Research Papers:

Prognostic value of integrin variants and expression in post-operative patients with HBV-related hepatocellular carcinoma

PDF |  HTML  |  Supplementary Files  |  How to cite

Oncotarget. 2017; 8:76816-76831. https://doi.org/10.18632/oncotarget.20161

Metrics: PDF 1449 views  |   HTML 2384 views  |   ?  

Liming Shang, Xinping Ye, Guangzhi Zhu, Hao Su, Zhixiong Su, Bin Chen, Kaiyin Xiao, Lequn Li, Minhao Peng and Tao Peng _

Abstract

Liming Shang1,*, Xinping Ye1,*, Guangzhi Zhu1,*, Hao Su1, Zhixiong Su1, Bin Chen1, Kaiyin Xiao1, Lequn Li2, Minhao Peng1 and Tao Peng1

1Department of Hepatobiliary Surgery, The First Affiliated Hospital of Guangxi Medical University, Nanning, China

2Department of Hepatobiliary Surgery, Affiliated Tumor Hospital of Guangxi Medical University, Nanning, China

*These authors have contributed equally to this work

Correspondence to:

Tao Peng, email: [email protected]

Keywords: integrin, SNPs, ITGA5, ITGB5, hepatocellular carcinoma

Received: January 17, 2017    Accepted: June 20, 2017    Published: August 10, 2017

ABSTRACT

Integrins are a large family of cell surface receptors that bind extracellular matrix proteins and participate in cancer progression. However, the prognostic value of integrin family genes in post-operative patients with HBV-related hepatocellular carcinoma (HCC) remains unknown. In this study, we investigated 18 single nucleotide polymorphisms (SNPs) in integrin family genes and found that the AG/GG genotypes at rs988574 in ITGA1 predicted a better prognosis compared to carriers of the AA genotype (P = 0.025, HR = 0.69, 95%CI = 0.50–0.96). Moreover, rs988574 genotype combined with serum level of AFP had a better prognostic value in HBV-related HCC patients (P = 0.026, HR = 1.75, 95% CI = 1.07–2.85). Furthermore, we compared the expression of 24 integrin family genes in HBV-related HCC tissues and adjacent normal tissues. Survival analysis demonstrated that expression of three of the family members, ITGA5, ITGB5 and ITGA2B, were significantly associated with the overall survival (OS) or relapse-free survival (RFS) of HBV-related HCC patients. Additionally, patients with lower expression of both ITGA5 and ITGB5 had the best OS and RFS (P = 0.017 and P = 0.002, respectively). Our study demonstrated that rs988574 of ITGA1 and the expression of ITGA5, ITGB5 and ITGA2B are potential independent prognostic bio-markers and therapeutic targets for HBV-related HCC patients and may be useful for the diagnosis of HBV-related HCC.


INTRODUCTION

Hepatocellular carcinoma (HCC) is the second leading cause of cancer-related death worldwide [1]. More than 500,000 patients are newly diagnosed with HCC every year, and 50% of all cases and deaths are in China [2, 3]. Among these, most are hepatitis B virus (HBV)-related HCC patients. Although advances in treatment, especially in surgical techniques and molecular targeted therapy, have improved the survival rates of HCC patients, the long term prognosis after surgical resection remains very poor [4-6]. Thus, early diagnosis and treatment are very important to improve the prognosis of HCC patients [7-10]. Multiple clinical factors have been used as indicators for the diagnosis and evaluation of HCC, for instance, drinking status, chronic HBV or hepatitis C virus (HCV) infections, large tumor size, vascular invasion, positive portal vein thrombosis, serum alpha fetoprotein (AFP) and Barcelona Clinic Liver Cancer (BCLC) stage [11-13]. Current indicators used to predict HCC outcomes and the prognosis of HCC patients are not sufficient. Thus, it is urgent to identify potential biomarkers for improving the efficacy of prognosis prediction and the clinical outcomes of HCC patients.

The integrin family consists of 18 α and 8 β subunits that form 24 known αβ-heterodimers. Both α and β subunits have a large NH2-terminal extracellular domain, a single transmembrane domain and a short non-catalytic cytoplasmic tail [14, 15]. Integrins are involved in a wide range of biological activities and pathological processes, especially carcinogenesis and cancer progression [16, 17]. They regulate cell–cell and cell–ECM interactions, and this ‘outside-in’ signaling activates a number of signaling pathways that are important in the regulation of cell shape, survival, gene transcription and migration [18, 19]. They also interact with growth factors or chemokines to regulate cell growth and differentiation [14, 20]. Thus, targeting integrins and their associated signaling pathways, which are involved in tumor proliferation, migration, invasion and metastasis, may be a novel strategy for the diagnosis and treatment of cancers as well as certain non-neoplastic conditions [21]. Studies have also reported that effective blockage of integrins and ECM interactions impairs several important aspects of tumor biology and increases sensitivity to existing chemotherapy [22, 23]. Anti-integrin antagonists used in combination with current chemotherapeutic drugs have been shown to have roles in preventing drug resistance and tumor relapse [24].

In this study, we evaluated the prognostic predictive value of integrin family genes and ITGA1 single nucleotide polymorphism (SNP) rs988574 in HBV-related HCC patients by performing prognostic analysis in 221 newly diagnosed pathologically confirmed HBV-related HCC patients. First, we found that ITGA5 and ITGB5 are more highly expressed in HBV-related HCC tissues than adjacent normal tissues. Conversely, ITGA2B is more highly expressed in adjacent normal tissues than in HBV-related HCC tissues. We also found that higher expression of ITGA5, ITGB5 and ITGA2B predicted worse prognosis in HBV-related HCC patients, and patients with lower expression of both ITGA5 and ITGB5 had the best prognosis. In addition, we found that patients carrying the AG or GG genotypes at rs988574 had better prognosis than those with the AA genotype.

RESULTS

Patient characteristics and clinical predictors

The clinical and pathologic characteristics of the patients are shown in Table 1. Overall, 55 female patients and 430 male patients were included. Among them, 307 were Han Chinese and 178 were minorities. The median survival times were 57 and 51 months for patients aged ≤46 years and >46 years, respectively. As shown in Table 1 univariate analysis indicated that patients with BCLC stages B and C (HR = 1.92, 95%CI = 1.35–2.73; HR = 3.1, 95%CI = 2.31–4.16, respectively), Child-Pugh class B (HR = 1.68, 95%CI = 1.21–2.33), non-radical resection (HR = 0.76, 95%CI = 0.59–0.99), non-antiviral therapies (HR = 0.72, 95%CI = 0.53–0.98), AFP ≥ 300ng/ml (HR = 1.30, 95%CI = 0.99–1.71), tumor size ≥ 5 cm (HR = 2.04, 95%CI = 1.49–2.80), multiple tumors (n > 1) (HR = 1.61, 95%CI = 1.23–2.12) and presence of PVTT (HR = 2.40, 95%CI = 1.12–5.12) had higher risk of death when compared with patients with BCLC stage A, child-Pugh class A, radical resection, antiviral therapies, AFP < 300 ng/ml, tumor size < 3cm, single tumor (n = 1) and absence of PVTT, respectively. In addition, clinical features including age, gender, race, BMI, drinking status, smoking status, adjuvant TACE and cirrhosis were found to have no effect on the OS of HBV-related HCC patients in our study.

Table 1: Univariate Cox proportional hazards analysis of clinicopathological characteristics and overall survival in HBV-related HCC patients

(Continued)

Variables

Patients (n=485)

OS

MST (months)

HR * (95% CI)

P *

Age (yr)

 

 

 

 

 ≤ 46

260

57

Ref.

 

 > 46

225

51

0.97 (0.74–1.25)

0.789

Gender

 

 

 

 

 male

430

51

Ref.

 

 female

55

80

0.75 (0.47–1.18)

0.208

Race

 

 

 

 

 Han

307

68

Ref.

 

 Minority

178

51

1.10 (0.84–1.45)

0.473

BMI

 

 

 

 

 ≤ 25

401

58

Ref.

 

 > 25

84

57

0.95 (0.68–1.32)

0.737

Smoking status

 

 

 

 

 None

318

71

Ref.

 

 Ever

167

42

1.20 (0.91–1.57)

0.191

Drinking status

 

 

 

 

 None

295

71

Ref.

 

 Ever

190

48

1.18 (0.91–1.53)

0.219

Adjuvant TACE a

 

 

 

 

 No

212

88

Ref.

 

 Yes

273

47

1.14 (0.87–1.49)

0.340

BCLC stage

 

 

 

 

 A

284

95

Ref.

< 0.001

 B

80

47

1.92 (1.35–2.73)

< 0.001

 C

121

24

3.10 (2.31–4.16)

< 0.001

Child–Pugh class

 

 

 

 

 A

403

65

Ref.

 

 B

82

34

1.68 (1.21–2.33)

0.002

Cirrhosis

 

 

 

 

 No

58

82

Ref.

 

 Yes

426

51

1.21 (0.80–1.84)

0.361

Antiviral therapyb

 

 

 

 

 No

315

47

Ref.

 

 Yes

170

81

0.72 (0.53–0.98)

0.036

AFP

 

 

 

 

 ≤ 400 (ng/ml)

247

63

Ref.

 

 > 400 (ng/ml)

202

42

1.30 (0.99–1.71)

0.059

 missing

36

 

 

 

Radical resection

 

 

 

 

 No

205

41

Ref.

 

 Yes

268

74

0.76 (0.59–0.99)

0.044

 missing

12

 

 

 

Pathological grade

 

 

 

 

 Well

27

79

Ref.

0.761

 Moderately

372

51

1.25 (0.68–2.30)

0.470

 Poorly

13

NA

1.15 (0.40–3.31)

0.797

 missing

73

 

 

 

Oncological behavior

 

 

 

 

Tumor size

 

 

 

 

 ≤ 5 cm

155

123

Ref.

 

 > 5 cm

330

40

2.04 (1.49–2.80)

< 0.001

No. of tumors

 

 

 

 

 Single (n = 1)

356

63

Ref.

 

 Multiple (n > 1)

129

35

1.61 (1.23–2.12)

0.001

Regional invasion

 

 

 

 

 Absence

412

68

Ref.

 

 Presence

73

37

1.62 (1.137–2.30)

0.007

Intrahepatic metastasis

 

 

 

 

 Absence

264

81

Ref.

 

 Presence

221

35

1.80 (1.38–2.33)

< 0.001

Vascular invasion

 

 

 

 

 Absence

399

78

Ref.

 

 Presence

86

18

3.16 (2.35–4.25)

< 0.001

PVTT

 

 

 

 

 No

409

76

Ref.

< 0.001

 vp1

11

28

2.40 (1.12–5.12)

0.024

 vp2

17

17

3.44 (1.99–5.96)

< 0.001

 vp3

40

17

2.89 (1.96–4.27)

< 0.001

 vp4

8

8

5.84 (2.72–12.54)

< 0.001

Note: *HR and P-value for univariate survival analysis;aAdjuvant TACE post hepatectomy;bAdjuvant antiviral therapy post hepatectomy;

OS, overall survival; MST, median survival time; HR, hazard ratio; 95% CI, 95% confidence interval; Ref., reference; PVTT, portal vein tumor thrombus.

ITGA1 SNP rs988574-AA predicted worse OS in HBV-related HCC patients

The SNP functional prediction results showed that rs988574 located in a splice site and the non-synonymous mutation was possibly damaging for gene expression as predicted by Polyphen in SNP selection tools. In this study, we found that patients carrying the AG/GG alleles of rs988574 had a significantly better prognosis when compared to patients with the AA genotype. Cox proportional hazards regression analysis showed that rs988574 was significantly associated with prognosis when adjusting for age, gender, race, smoking status, drinking status, BMI, child-Pugh class, cirrhosis, BCLC stage, pathological grade, TACE status post hepatectomy, antiviral therapy after hepatectomy, radical resection and serum AFP levels (Tables 2 and 3). Figure 1A shows that patients with the AG genotype had a significantly favorable OS, compared to patients with the AA genotype. Additionally, when combining carriers of the AG and GG alleles, patients with the AA genotype had a worse prognosis (Figure 1B). The adjusted survival curve shows a significant difference in OS between patients with the AG and GG genotypes of rs988574 compared to those with the AA genotype (P = 0.025, HR = 0.69 95%CI = 0.50–0.96; Table 3).

Table 2: Multivariate Cox proportional hazards ratio analysis of ITGA1 SNPs and overall survival or relapse free survival in HBV-related HCC patients

SNP

Chr

Position

Gene

Allele

Function

MAF

os

Log-rank P

Cox P

rs1531545

5

52193287

ITGA1

C/T

Synonymous

0.34

0.208

0.301

rs4145748

5

52201722

ITGA1

C/T

Nonsynonymous

0.09

0.414

0.455

rs2279587

5

52214581

ITGA1

G/A

Nonsynonymous

0.11

0.257

0.312

rs12520591

5

52229745

ITGA1

T/G

Nonsynonymous

0.11

0.378

0.356

rs988574

5

52240810

ITGA1

A/G

Nonsynonymous

0.14

0.002

0.043£

rs2230392

17

48155425

ITGA3

G/A

Nonsynonymous

0.29

0.219

0.374

rs1143674

2

182374534

ITGA4

A/G

Synonymous

0.36

0.453

0.499

rs1143676

2

182395345

ITGA4

G/A

Nonsynonymous

0.12

0.182

0.386

rs7562325

2

182399097

ITGA4

T/C

Synonymous

0.36

0.420

0.429

rs11895564

2

173339808

ITGA6

G/A

Nonsynonymous

0.06

0.516

0.604

rs1800974

12

56089357

ITGA7

C/T

Nonsynonymous

0.06

0.108

0.156

rs2298033

10

15649710

ITGA8

G/A

Nonsynonymous

0.06

0.886

0.901

rs2507941

3

37536056

ITGA9

C/T

Synonymous

0.08

0.737

0.825

rs267561

3

37574951

ITGA9

G/A

Nonsynonymous

0.22

0.284

0.355

rs2274616

1

145536082

ITGA10

G/A

Nonsynonymous

0.07

0.479

0.622

rs2230433

16

30518041

ITGAL

G/C

Nonsynonymous

0.19

0.766

0.812

rs871443

17

73753503

ITGB4

T/C

Nonsynonymous

0.37

0.580

0.635

rs2291089

3

124515636

ITGB5

C/T

Nonsynonymous

0.10

0.299

0.427

Note: Cox P adjusted for age, gender, BMI, race, smoking status, drinking status, Child-Pugh class, cirrhosis, BCLC stage, pathological grade, TACE status post hepatectomy, antiviral therapy after hepatectomy, radical resection, serum AFP levels, intrahepatic metastasis, vascular invasion and PVTT. £Sequencing map of rs988574 was shown in Supplementary Figure 1.

SNP, single nucleotide polymorphism; Chr, chromosome; MAF, minor allele frequency; OS, overall survival.

Table 3: Multivariate Cox proportional hazards ratio analysis of ITGA1 SNP rs988574 and overall survival in HBV-related HCC patients

SNP

Patients (n=485)

OS

MST (months)

HR (95% CI)

P

Adjusted HR* (95%CI)

Adjusted P *

rs988574

 

 

 

 

 

 

AA

345

42

Ref.

0.003

Ref.

0.052

AG

135

88

0.65 (0.47–0.88)

0.006

0.67 (0.48–0.93)

0.018

GG

5

14

2.53 (0.94–6.83)

0.067

1.30 (0.40–4.25)

0.659

AG+GG

140

82

0.68 (0.51–0.93)

0.014

0.69 (0.50–0.96)

0.025

Note: *Adjusted for age, gender, BMI, race, smoking status, drinking status, Child-Pugh class, cirrhosis, BCLC stage, pathological grade, TACE status post hepatectomy, antiviral therapy after hepatectomy, radical resection, serum AFP levels, intrahepatic metastasis, vascular invasion and PVTT.

SNP, single nucleotide polymorphism; OS, overall survival; MST, median survival time; HR, hazard ratio; 95% CI, 95% confidence interval; Ref., reference.

Prognostic value of ITGA1 SNP rs988574 genotype in HBV-related HCC patients.

Figure 1: Prognostic value of ITGA1 SNP rs988574 genotype in HBV-related HCC patients. (A, B) Kaplan-Meier graphs representing the probabilities of overall survival in HCC patients; (C) Kaplan-Meier graph showing the overall survival by rs988574 genotype combined with serum AFP level in HBV-related HCC patients.

Stratified analysis also utilized to investigate the association between clinicopathological features and HBV-related HCC outcomes. In stratified analyses, the AG/GG genotype ofrs988574 significantly decreased risk of death among HBV-related HCC patients with BCLC A stage, intrahepatic metastasis, advanced pathological grade, adjuvant TACE and patients without PVTT and vascular invasion (Figure 2) after hepatectomy, compared to patients with the AA genotype.

Stratified analysis of association between ITGA1-rs988574 polymorphisms and OS in HBV-related HCC patients.

Figure 2: Stratified analysis of association between ITGA1-rs988574 polymorphisms and OS in HBV-related HCC patients. Variables were stratified according to favorable and adverse strata.

Prognostic value of rs988574 combined with serum AFP level on OS in HBV-related HCC patients

In this study, we further analyzed the combined effect of rs988574 and serum AFP level on the prognosis of patients. According to rs988574 genotype and serum AFP level, patients were classified into four groups: AFP ≤ 400 ng/mL with AG/GG genotype, AFP ≤ 400 ng/mL with AA genotype, AFP > 400 ng/mL with AG/GG genotype and AFP > 400 ng/mL with AA genotype (Table 4). Multivariate Cox regression analysis indicated that, as compared to patients with AG/GG genotype and low serum AFP (AFP ≤ 400 ng/ml), patients with the AA genotype and a high serum AFP (AFP > 400 ng/mL) had a significantly higher risk for death (adjusted P = 0.026, adjusted HR = 1.75, 95%CI = 1.07–2.85; Table 4 and Figure 1C).

Table 4: Multivariate Cox proportional hazards ratio analysis combining ITGA1 SNP rs988574 and APF level for overall survival in HBV-related HCC patients

SNP

MST (months)

HR (95%CI)

P

HR *(95%CI)

P *

rs988574

 

 

 

 

 

AFP ≤ 400 (ng/mL) +AG/GG

79

Ref.

0.019

Ref.

0.094

AFP > 400 (ng/mL) + AG/GG

88

1.41 (0.80–2.48)

0.230

1.23 (0.68–2.22)

0.490

AFP ≤ 400 (ng/mL) + AA

57

1.59 (1.00–2.53)

0.048

1.60 (0.99–2.59)

0.056

AFP > 400 (ng/mL) + AA

36

2.05 (1.28–3.27)

0.003

1.75 (1.07–2.85)

0.026

Note:*Adjusted for age, gender, BMI, race, smoking status, drinking status, Child-Pugh class, cirrhosis, BCLC stage, pathological grade, TACE status post hepatectomy, antiviral therapy after hepatectomy, radical resection, intrahepatic metastasis, vascular invasion and PVTT.

SNP, single nucleotide polymorphism; MST, median survival time; HR, hazard ratio; 95% CI, 95% confidence interval; Ref., reference.

The mRNA expression level of integrins in HCC tissues and adjacent normal tissues

The integrin family consists of 24 genes, widely studied in the progression of various cancers. To clarify the expression pattern of integrin family members in HBV-related HCC patients, we compared the mRNA expression levels between HBV-related HCC tissues and adjacent normal tissues. The results showed that nine of the integrin gene family members have a higher expression in HBV-related HCC tissues compared to adjacent normal tissues (Figure 3A; P < 0.001). In a multivariate Cox proportional hazards ratio analysis adjusting for age, gender, cirrhosis, BCLC stage and serum AFP levels, we found that among the 24 integrin family genes, ITGA5, ITGB5 and ITGA2B were significantly associated with prognosis in terms of OS or RFS of patients with HBV-related HCC (Tables 5 and 6; P < 0.05). Then, we compared the expression of ITGA5, ITGB5 and ITGA2B in 221 HBV-related HCC tissues and 221 adjacent normal tissues, and the results showed that ITGA5 and ITGB5 are more highly expressed in HBV-related HCC tissues than adjacent normal tissues, while ITGA2B had a lower expression level in HBV-related HCC tissues than adjacent normal tissues (Figure 3B; P < 0.001).

Integrin family genes&rsquo; expression levels in HCC tissues and adjacent normal tissues.

Figure 3: Integrin family genes’ expression levels in HCC tissues and adjacent normal tissues. (A) Histogram of log-fold change showing the 24 integrin family members’ expression levels in HBV-related HCC tissues compared with adjacent normal tissues. (B) Comparison of the expression of ITGA5, ITGB5 and ITGA2B in 221 HBV-related HCC tissues and adjacent normal tissues. P-value indicates statistical significance analyzed by Student’s t-test.

Table 5: Multivariate Cox proportional hazards ratio analysis of integrin genes expression and overall survival or relapse free survival in HBV-related HCC patients

Integrins

OS

RFS

Log-rank P

Cox P*

Log-rank P

Cox P*

ITGA1

0.861

0.438

0.793

0.471

ITGA2

0.241

0.762

0.305

0.727

ITGA2B

0.230

0.064

0.172

0.032

ITGA3

0.209

0.217

0.721

0.997

ITGA4

0.138

0.327

0.069

0.095

ITGA5

0.013

0.041

0.003

0.006

ITGA6

0.885

0.337

0.377

0.089

ITGA7

0.126

0.169

0.438

0.407

ITGA8

0.579

0.826

0.877

0.784

ITGA9

0.481

0.813

0.094

0.072

ITGA10

0.509

0.567

0.308

0.510

ITGAE

0.528

0.464

0.906

0.913

ITGAL

0.803

0.913

0.562

0.672

ITGAM

0.463

0.677

0.439

0.777

ITGAV

0.411

0.172

0.825

0.692

ITGAX

0.877

0.079

0.517

0.879

ITGB1

0.403

0.822

0.340

0.846

ITGB2

0.902

0.654

0.514

0.298

ITGB3

0.614

0.154

0.042

0.064

ITGB4

0.716

0.983

0.735

0.407

ITGB5

0.016

0.048

0.069

0.042

ITGB6

0.434

0.928

0.625

0.768

ITGB7

0.451

0.635

0.523

0.591

ITGB8

0.945

0.919

0.615

0.760

Note: The 75th percentile of mRNA expression in the total population was used as the cutoff point to define lower and higher expression groups. *Cox P adjusted for age, gender, cirrhosis, BCLC stage and serum AFP levels.

OS, overall survival; RFS, relapse-free survival.

Table 6: Multivariate Cox proportional hazards ratio analysis of ITGA5, ITGB5 and ITGA2B expression and overall survival or relapse-free survival in HBV-related HCC patients

Gene

Patients (n=221)

OS

RFS

MST (months)

HR* (95%CI)

P value*

MRT (months)

HR* (95%CI)

P value*

ITGA5

 

 

 

 

 

 

 

 Lower

165

67.4

Ref.

0.041

51.6

Ref.

0.006

 Higher

56

45.9

1.64 (1.02–2.63)

 

21.3

1.75 (1.18–2.62)

 

ITGB5

 

 

 

 

 

 

 

 Lower

165

67.4

Ref.

0.048

49.1

Ref.

0.042

 Higher

56

53

1.62 (1.00–2.60)

 

23.6

1.53 (1.02–2.31)

 

ITGA2B

 

 

 

 

 

 

 

 Lower

165

67.3

Ref.

0.064

48

Ref.

0.032

 Higher

56

58.4

1.58 (0.97–2.73)

 

24.6

1.56 (1.04–2.33)

 

Note: The 75th percentile of mRNA expression in the total population was used as the cutoff point to define lower and higher expression groups. *Adjusted for age, gender, cirrhosis, BCLC stage and serum AFP levels.

OS, overall survival; RFS, relapse-free survival; MST, median survival time; MRT, median relapse time; HR, hazard ratio; 95% CI, 95% confidence interval; Ref., reference.

The adjusted survival curves showed a significant difference in OS and RFS between patients with higher versus lower ITGA5, ITGB5 and ITGA2B expression levels. (Figure 4). The mRNA expression levels of ITGA5, ITGB5 and ITGA2B were independent prognostic indicators in HBV-related HCC patients (Table 6). Co-expression analysis indicated that ITGA5 mRNA expression had a significantly positive correlation with ITGB5 (r=0.32, P<0.001) in tumor tissue, whereas ITGA2B had a significantly negative correlation with ITGA5 (r=-0.142, P =0.035) and ITGB5 (r=-0.34, P <0.001), respectively.

Prognostic value of ITGA5, ITGB5 and ITGA2B expression levels in HBV-related HCC patients.

Figure 4: Prognostic value of ITGA5, ITGB5 and ITGA2B expression levels in HBV-related HCC patients. Kaplan-Meier plot representing the probabilities of overall survival and relapse-free survival in HCC patients stratified according to the expression levels of ITGA5 (A, B), ITGB5 (C, D) and ITGA2B (E, F).

Prognostic prediction of ITGA5 expression combined with ITGB5 expression in HBV-related HCC patients

Base on the results of the co-expression and survival analysis for individual integrin genes, we analyzed the prognostic predictive value of combining ITGA5 and ITGB5 expression. The results showed that patients with higher expression of both ITGA5 and ITGB5 had the worst OS and RFS compared to patients with lower expression of these genes (Figure 5 and Table 7; P = 0.017 and 0.002, respectively).

Prognostic value of ITGA5 expression combined with ITGB5 expression in HBV-related HCC patients.

Figure 5: Prognostic value of ITGA5 expression combined with ITGB5 expression in HBV-related HCC patients. Kaplan-Meier plots showing the overall survival (A) and relapse-free survival (B) of combining ITGA5 and ITGB5 mRNA expression.

Table 7: Multivariate Cox proportional hazards ratio analysis combining ITGA5 and ITGB5 expression and overall survival or relapse-free survival in HBV-related HCC patients

Groups (ITTGA5 & ITGB5)

Patients (n=221)

OS

RFS

MST (months)

HR* (95%CI)

P value*

MRT (months)

HR* (95%CI)

P value*

Both Lower

130

67.4

Ref.

0.017

54.8

Ref.

0.002

Lower/Higher

70

53.3

1.37 (0.84–2.25)

0.212

36.0

1.38 (0.91–2.07)

0.127

Both Higher

21

17.6

2.58 (1.34–4.95)

0.004

13.1

2.89 (1.61–5.18)

<0.001

Note: The 75th percentile of mRNA expression in the total population was used as the cutoff point to define lower and higher expression groups. *Adjusted for age, gender, cirrhosis, BCLC stage and serum AFP levels.

OS, overall survival; RFS, relapse-free survival; MST, median survival time; MRT, median relapse time; HR, hazard ratio; 95% CI, 95% confidence interval; Ref., reference.

DISCUSSION

In this study, we examined whether genetic polymorphisms in the integrin gene family are associated with the OS of HBV-related HCC patients and explored the expression pattern and prognostic predictive value of these genes using GEO data. We found that the AG/GG genotypes of rs988574 (ITGA1) are significantly associated with better OS compared with the AA genotype in HBV-related HCC patients. In addition, we found that patients with the AA genotype combined with high serum AFP (AFP > 400 ng/mL) predicted the highest risk of death. Additionally, among the 24 integrin family members, nine had higher expression in HBV-related HCC tissues compared to adjacent normal tissues, while the other integrin genes showed the opposite expression pattern. Specifically, the expression of ITGA5 and ITGB5 were higher in HCC tissues than in adjacent tissues. In contrast, the expression of ITGA2B was the opposite, and significantly negative correlation with ITGA5 and ITGB5 in tumor tissue. Furthermore, we found that the expression level of ITGA5, ITGB5 and ITGA2B were associated with the prognosis of HBV-related HCC patients; lower expression of these genes predicted a better OS and RFS compared with higher expression. Furthermore, we found that patients with the combination of lower expression of both ITGA5 and ITGB5 had the best OS and RFS.

Our SNP functional prediction results show that rs988574 disrupts a splice site, and this non-synonymous mutation was possibly damaging for gene expression as predicted by Polyphen in SNP selection tools. This may a potential mechanism that AA polymorphism of rs988574 affects functionality of ITGA1 in respect to the HBV-related HCC. Moreover, we demonstrated that the SNP rs988574 in ITGA1 may serve as an independent prognostic marker in HBV-related HCC patients. Once validated, these genes, either alone or in combination with each other or other traditional clinical-prognostic factors, may be used as new targets for the treatment of HBV-related HCC patients.

Integrins are a large family of cell surface receptors that bind ECM proteins to regulate attachment, cell proliferation, differentiation, motility and other essential cell functions [25]. They are critically important for both health and disease by participating in diverse human pathologies including thrombotic diseases, infectious diseases, inflammation, fibrosis and cancer [24]. Integrins play an important role in cancer survival, proliferation, growth and metastasis [26-28]. Apart from their correlation with cancer prognosis, integrins can also protect cells from stress, leading to cancer cell resistance to radio- and chemotherapy [29]. Additionally, integrin inhibition has been shown to enhance the cytotoxic efficacy of radiation and chemotherapeutics [30]. Reports have also shown that integrins are sensitive to pharmacological blockade, making them exciting pharmacological targets for anticancer therapies [31]. Indeed, several integrin inhibitors have been designed and have undergone clinical trials, and all were shown to be nontoxic.

Some studies have shown that integrins, such as beta1, beta3 and beta5, play an important role in cell growth, proliferation, invasion and migration [31]. It has also been demonstrated that integrin levels are frequently elevated in aggressive tumors, implying that these proteins might be promising targets for cancer treatments [32]. ITGA5 is a member of the integrin family that mediates cell-to-cell adhesion, migration and anoikis in virous tumors both in vivo and in vitro [33, 34]. Additionally, ITGA5 promotes tumor cell adhesion and migration through activating focal adhesion kinase (FAK), and an antibody (Volociximab) or a non–RGD-based peptide inhibitor (ATN-161), which blocks the function of the heterodimer function, significantly inhibits the growth and metastasis of breast cancer cells [23, 34]. ITGB5 also promotes intracellular signaling by recruiting and activating integrin-associated kinases, including FAK, which contributes to chemoresistance in malignant disease. FAK, interacting with Src at Tyr861, plays a vital role in ITGB5-mediated signaling in response to vascular endothelial growth factor (VEGF) and Ras transformation in fibroblasts [31]. These features suggest that ITGB5 may participate in tumor cell adhesion, migration, inhibits metastasis, and angiogenesis, all of which may influence tumor prognosis. Our current study demonstrated that ITGB5 expression was related to HBV-related HCC prognosis, and the features of ITGB5 may play a role in HBV-related HCC prognosis, but this hypothesis still need further functional experiment investigation. ITGA2B, also known as platelet glycoprotein IIb of the IIb/IIIa complex, is the most abundant receptor on the platelet surface [35]. By binding platelets together, it has a significant role in hemostasis. Recent studies have suggested that platelets may contribute to the spread of cancer, and cancer patients may have both an elevated number of, and activated, platelets [36]. One study also reported that the platelet glycoprotein IIb/IIIa (GP IIb/IIIa) is crucial for the hematogenous metastasis of human breast carcinoma cells [37]. Based on previous research, these functions may play a role in the prognostic of ITGA2B expression in HBV-related HCC.

In previous reports, focus has been placed on investigating the biological behavior and prognostic roles of integrin family members in various cancers. Our results were consistent with a previous study, which found that the expression of ITGA5 was associated with the prognosis of HBV-related HCC patients [34]. Furthermore, we found that the ITGB5 expression level was higher in HCC tissues, while ITGA2B was higher in adjacent normal tissues. Furthermore, both of these genes were associated with the prognosis of HBV-related HCC patients. In addition, this is the first study to detect the prognostic predictive value of combining the expression of ITGA5 with ITGB5. Finally, we found that the AG/GG genotypes at rs988574 (ITGA1) are significantly associated with better OS compared with carriers of the AA genotype in HBV-related HCC patients. The biggest challenge in this study was how to detect gene expression homogeneously since the data was influenced by various conditions, such as bias from the specific cell populations in the tumor tissues, the sampling sites and sample degradation, problems that have also occurred in other studies.

In summary, our study demonstrated that the expression of ITGA5, ITGB5 and ITGA2B, as well as the genotype at rs988574 (ITGA1), may be potential independent prognostic bio-markers and therapeutic targets for HBV-related HCC patients and may be useful in the diagnosis of HBV-related HCC patients. Further studies focused on integrin family members and their downstream signaling pathways, as well as the effective blockage of integrins and their ECM interactions, will provide additional information about their use in cancer therapies.

METERIALS AND METHODS

Ethical approval

This study was performed in support of the Ethical Review Committee of the First Affiliated Hospital of Guangxi Medical University (Guangxi, China), and informed consent was obtained from all patients.

Study population

A total of 485 newly diagnosed pathologically confirmed HBV-related HCC patients that had undergone surgical resection were recruited at the First Affiliated Hospital of Guangxi Medical University (Guangxi, China) from January 2005 to September 2014. All the patients were diagnosed by histopathological examination which followed the National Comprehensive Cancer Network (NCCN) clinical practice guidelines for oncology. The patients were followed up via telephone or hospital visit until death or final follow-up in September 2014, for a median follow-up time of 47 months. None of the patients had a previous cancer diagnosis of any kind at the initial screening examination. The clinicopathological characteristics of patients including age, gender, smoking status, drinking status, pathological grade, biobehavior of their cancer, serum AFP level, hepatic cirrhosis, radical resection and use of transcatheter hepatic arterial chemoembolization (TACE) were obtained from medical records and pathological reports. Tumor status was classified according to the BCLC staging system. Child-Pugh class was defined as previously published. Portal vein tumor thrombus (PVTT) was determined to be absent or present. The endpoint was overall survival (OS), which was calculated from the date of pathological diagnosis/recruitment to death or the end of follow-up.

SNP selection, DNA extraction and genotyping

SNP selection tools (http://snpinfo.niehs.nih.gov/snpinfo/snpfunc.htm) were used to select candidate SNPs in integrin genes according a previous publication. The inclusion criteria were as follows: (i) SNPs in splice sites and CDS regions resulting in amino acid changes; SNPs in transcription factor binding sites of the 5’ flanking region; and SNPs in miRNA binding sites of 3’ UTR; and (ii) SNPs with minor allele frequency (MAF) ≥ 10% in the Han Chinese population (CHB) from the 1000 Genomes Project (March 2012, build GRCh37/hg19) [38]. These criteria resulted in18 SNPs being identified for assessment in this study (Table 8).

Table 8: Primers for SNPs of integrin genes

SNPs

Primers

Sequences (5′-3′)

Annealing temperature (°C)

Amp Length (bp)

rs1531545

Forward
Reverse

ACAAGCTCTACCAGGTATCTGTATTCT
TTCAAGCTATGAACTGCACGTTG

60

274

rs4145748

Forward
Reverse

AGAGCATATTAAAAGCTTCCACCAA
CACCCATCCAACATGAAGACAAAG

62

509

rs2279587

Forward
Reverse

GAAATGGAGTCCTGAGCGCTGT
GGAGTGTTGAGGGCACTGCAT

62

533

rs12520591

Forward
Reverse

CGTTTCAAGGTAAATGAATTCCCCTAT
GAGGCTTAGATCTCTAAACTGATGTG

61

510

rs988574

Forward
Reverse

GAGGGAGGACAAGTGCACGG
GCAATACCAGTCACTGCTTAAGGGA

62

376

rs2230392

Forward
Reverse

CCCTCACCCAGAATAGGAGGAGG
CCTCCATTTCTGCCTGCTTTACA

63

580

rs1143674

Forward
Reverse

ATAGTGTTTGGCCCTTTTCAGGAA
TCTTCACTGGCAAGGCATTAAAA

61

508

rs1143676

Forward
Reverse

TTGGCTGGGTTTTTGTGTTTCTG
GACCCTGGGTCTATCTCAACTT

62

494

rs7562325

Forward
Reverse

AAACCTCTAGCTAGAAGGTAAAGATCC
GCCCATTTTCTTGCTGGTTCTAATA

62

515

rs11895564

Forward
Reverse

GGAGTCCTGCTGTACTATGGTTCT
CAGCAGCGCTATTATTTAAACAATCA

61

501

rs1800974

Forward
Reverse

GTCCTCTTCCACCTTCTGCCTTT
CAGTGTGGCCCAGCTCTTGAC

61

493

rs2298033

Forward
Reverse

AATGGTTGGAATTTGGATATGAAGGAGA
TCTGATAGAGCACTGTGTTCACTG

60

272

rs2507941

Forward
Reverse

GCACTCGTGGGAAGTGGCTG
GGGCACAACCTGACTGAATGTC

60

501

rs267561

Forward
Reverse

ATCCTGTTGGTCTAGTTCTTGTTTG
TGGTCCAATGAGGCTTCAGTCTAG

62

512

rs2274616

Forward
Reverse

GGGAAGCAAACACTGGGCTTG
CTCCTTACCAGCACATGGAAGT

62

492

rs2230433

Forward
Reverse

ATTTATTTCTTTCTGGCCCACCA
TAAACCTGGTACCTCGGATCATACA

60

410

rs871443

Forward
Reverse

TAGGCACCTGTCCTTTCCTTCACC
GAGTCGGGAGGACGCCTAGTG

62

497

rs2291089

Forward
Reverse

AGCCGCACGTGCAGTTGTAG
GGCTGGGAAGAGGATAGGACAGAA

62

494

SNPs, single nucleotide polymorphisms.

HCC tissues collected after surgical resection from HBV-related HCC patients were immediately stored at −80°C until DNA extraction using the TIANamp Genomic DNA Kit (Tiangen Biotech, Beijing, China), and genotyping was performed using Sanger DNA sequencingby Shanghai Sangon Biological Engineering Technology & Services (Shanghai, China). All primers are shown in Table 8.

Integrin gene mRNA expression analyses in HBV-related HCC tissues

In the present study, we focus on the Chinese HBV-related HCC. The Gene Expression Omnibus (GEO) data selection criteria were set as follows: (i) expression profiling chip; (ii) Chinese HBV-related HCC; (iii) corresponding survival profiles available; (iv) patients undergoing hepatectomy. By searching the GEO database, we found that only the data of GSE14520 met the above criteria. Data were analyzed with Expression Console software (http://www.affymetrix.com/estore/index.jsp). Probe signal values were converted to log2 values, and annotated genes were analyzed using the corresponding Affymetrix HT Human Genome U133A and Human Genome U133A_2 array annotation files. A multi-array average algorithm was used for normalization of the GSE14520 mRNA expression data. We analyzed the association between the mRNA expression of integrin genes and prognosis in 221 HBV-related HCC patients using data from the GSE14520. The 75th percentile was used to define higher versus lower expression.

Statistical analysis

The pearson correlation coefficient was used to assess the co-expression correlation of integrin genes in tumor mRNA. OS was defined as the time from surgery to death due to HCC and relapse-free survival (RFS) was defined as the time from surgery to disease recurrence. Hazard ratios (HRs) and 95% confidence intervals (CIs) were estimated by the Cox proportional hazards model after adjusting for factors such as age, gender, AFP level, tumor differentiation and treatment after surgery. GraphPad Prism 6 was used to plot Kaplan–Meier survival curves, scatter diagrams and histograms. Differences in the mRNA expression of integrin genes between HCC tissues and non-HCC tissues were evaluated using Student’s t-test. Statistical significance was set at a level of P = 0.05, and all analyses were done using SPSS version 18.0 (SPSS, Inc., Chicago, IL, USA).

Author contributions

Liming Shang and Tao Peng designed this manuscript; Liming Shang, Xinping Ye, Guangzhi Zhu, Hao Su, zhixiong Su, Bin Chen, Kaiyin Xiao, Lequn Li, Minhao Peng and Tao Peng conducted the study, collected the tumor specimens and corresponding patients clinical data, follow-up and analyzed the data. Liming Shang wrote this manuscript and Tao Peng guided the writing.

Abbreviations

HCC, hepatocellular carcinoma; SNPs, single nucleotide polymorphisms; PCR, polymerase chain reaction; HBV, hepatitis B virus; SNPs, single nucleotide polymorphisms; OS, overall survival; RFS, recurrence-free survival; AFP, serum alpha fetoprotein; PVTT, portal vein tumor thrombosis; MAF, minor allele frequency; CDS, coding sequence; GEO, Gene Expression Omnibus; HR, hazard ratios; 95% CI, 95% confidence interval; MST, median survival time; MRT, median recurrence time.

ACKNOWLEDGMENTS

This work was supported in part by the National Natural Science Foundation of China (NSFC 81560535, 81072321, 30760243, 30460143, and 30560133), the 2009 Program for New Century Excellent Talents in University (NCET), a Guangxi Natural Sciences Grant (GuiKeGong 1104003A-7), and a Guangxi Health Ministry Medicine Grant (Key Scientific Research Grant Z201018). The authors thank the contributors of the GSE14520 for sharing their dataset on open access. In addition, We also would like to acknowledge the helpful comments on this paper received from our reviewers.

CONFLICTS OF INTEREST

The authors do not have any conflicts of interest.

REFERENCES

1. Siegel RL, Miller KD, Jemal A. Cancer statistics, 2016. CA Cancer J Clin. 2016; 66:7-30.

2. Wang Z, Wang J, Wang Q, Wang J, Yuan J, Si Y. A genetic variant in DICER gene is associated with prognosis of hepatocellular carcinoma in a Chinese population. Hepatol Res. 2016.

3. Fan C, Jin G, Sun C, Ma D, Chen C, Qiao P, Wu D. Clinical characteristics, treatment patterns and survival outcome of hepatocellular carcinoma patients aged 70 years or older: a single-center retrospective study from China. Aging Clin Exp Res. 2014; 26:123-130.

4. Chen XP, Huang ZY. Surgical treatment of hepatocellular carcinoma in China: surgical techniques, indications, and outcomes. Langenbecks Arch Surg. 2005; 390:259-265.

5. Choi KJ, Baik IH, Ye SK, Lee YH. Molecular targeted therapy for hepatocellular carcinoma: present status and future directions. Biol Pharm Bull. 2015; 38:986-991.

6. Qiao W, Yu F, Wu L, Li B, Zhou Y. Surgical outcomes of hepatocellular carcinoma with biliary tumor thrombus: a systematic review. BMC Gastroenterol. 2016; 16:11.

7. Grandhi MS, Kim AK, Ronnekleiv-Kelly SM, Kamel IR, Ghasebeh MA, Pawlik TM. Hepatocellular carcinoma: from diagnosis to treatment. Surg Oncol. 2016; 25:74-85.

8. Janevska D, Chaloska-Ivanova V, Janevski V. Hepatocellular carcinoma: risk factors, diagnosis and treatment. Open Access Maced J Med Sci. 2015; 3:732-736.

9. Llovet JM, Bruix J. Early diagnosis and treatment of hepatocellular carcinoma. Baillieres Best Pract Res Clin Gastroenterol. 2000; 14:991-1008.

10. Testino G, Leone S, Patussi V, Scafato E, Borro P. Hepatocellular carcinoma: diagnosis and proposal of treatment. Minerva Med. 2016; 107:413-426.

11. Li Z, Zhao X, Jiang P, Xiao S, Wu G, Chen K, Zhang X, Liu H, Han X, Wang S, Li X. HBV is a risk factor for poor patient prognosis after curative resection of hepatocellular carcinoma: a retrospective case-control study. Medicine. 2016; 95:e4224.

12. Su L, Zhou T, Zhang Z, Zhang X, Zhi X, Li C, Wang Q, Jia C, Shi W, Yue Y, Gao Y, Cheng B. Optimal staging system for predicting the prognosis of patients with hepatocellular carcinoma in China: a retrospective study. BMC Cancer. 2016; 16:424.

13. AlSalloom AA. An update of biochemical markers of hepatocellular carcinoma. Int J Health Sci. 2016; 10:121-136.

14. Sun CC, Qu XJ, Gao ZH. Integrins: players in cancer progression and targets in cancer therapy. Anticancer Drugs. 2014; 25:1107-1121.

15. Hynes RO. Integrins: bidirectional, allosteric signaling machines. Cell. 2002; 110:673-687.

16. Foubert P, Varner JA. Integrins in tumor angiogenesis and lymphangiogenesis. Methods Mol Biol. 2012; 757:471-486.

17. Lorger M, Krueger JS, O’Neal M, Staflin K, Felding-Habermann B. Activation of tumor cell integrin alphavbeta3 controls angiogenesis and metastatic growth in the brain. Proc Natl Acad Sci U S A. 2009; 106:10666-10671.

18. Schlaepfer DD, Hunter T. Focal adhesion kinase overexpression enhances ras-dependent integrin signaling to ERK2/mitogen-activated protein kinase through interactions with and activation of c-Src. J Biol Chem. 1997; 272:13189-13195.

19. Campbell ID, Humphries MJ. Integrin structure, activation, and interactions. Cold Spring Harb Perspect Biol. 2011; 3.

20. Bianchi A, Gervasi ME, Bakin A. Role of beta5-integrin in epithelial-mesenchymal transition in response to TGF-beta. Cell Cycle. 2010; 9:1647-1659.

21. Ruegg C, Alghisi GC. Vascular integrins: therapeutic and imaging targets of tumor angiogenesis. Recent results in cancer research Fortschritte der Krebsforschung Progres dans les recherches sur le cancer. 2010; 180:83-101.

22. Lesniak D, Xu Y, Deschenes J, Lai R, Thoms J, Murray D, Gosh S, Mackey JR, Sabri S, Abdulkarim B. Beta1-integrin circumvents the antiproliferative effects of trastuzumab in human epidermal growth factor receptor-2-positive breast cancer. Cancer Res. 2009; 69:8620-8628.

23. Desgrosellier JS, Cheresh DA. Integrins in cancer: biological implications and therapeutic opportunities. Nat Rev Cancer. 2010; 10:9-22.

24. Winograd-Katz SE, Fassler R, Geiger B, Legate KR. The integrin adhesome: from genes and proteins to human disease. Nat Rev Mol Cell Biol. 2014; 15:273-288.

25. Cabodi S, Di Stefano P, Leal Mdel P, Tinnirello A, Bisaro B, Morello V, Damiano L, Aramu S, Repetto D, Tornillo G, Defilippi P. Integrins and signal transduction. Adv Exp Med Biol. 2010; 674:43-54.

26. Garmy-Susini B, Varner JA. Roles of integrins in tumor angiogenesis and lymphangiogenesis. Lymphat Res Biol. 2008; 6:155-163.

27. Nemeth JA, Cher ML, Zhou Z, Mullins C, Bhagat S, Trikha M. Inhibition of alpha(v)beta3 integrin reduces angiogenesis, bone turnover, and tumor cell proliferation in experimental prostate cancer bone metastases. Clin Exp Metastasis. 2003; 20:413-420.

28. Genersch E, Ferletta M, Virtanen I, Haller H, Ekblom P. Integrin alphavbeta3 binding to human alpha5-laminins facilitates FGF-2- and VEGF-induced proliferation of human ECV304 carcinoma cells. Eur J Cell Biol. 2003; 82:105-117.

29. Mochmann LH, Neumann M, von der Heide EK, Nowak V, Kuhl AA, Ortiz-Tanchez J, Bock J, Hofmann WK, Baldus CD. ERG induces a mesenchymal-like state associated with chemoresistance in leukemia cells. Oncotarget. 2014; 5:351-362. https://doi.org/10.18632/oncotarget.1449.

30. Kim HS, Kim SC, Kim SJ, Park CH, Jeung HC, Kim YB, Ahn JB, Chung HC, Rha SY. Identification of a radiosensitivity signature using integrative metaanalysis of published microarray data for NCI-60 cancer cells. BMC Genomics. 2012; 13:348.

31. Wang S, Xie J, Li J, Liu F, Wu X, Wang Z. Cisplatin suppresses the growth and proliferation of breast and cervical cancer cell lines by inhibiting integrin beta5-mediated glycolysis. Am J Cancer Res. 2016; 6:1108-1117.

32. Kapp TG, Rechenmacher F, Sobahi TR, Kessler H. Integrin modulators: a patent review. Expert Opin Ther Pat. 2013; 23:1273-1295.

33. Qin L, Chen X, Wu Y, Feng Z, He T, Wang L, Liao L, Xu J. Steroid receptor coactivator-1 upregulates integrin alpha(5) expression to promote breast cancer cell adhesion and migration. Cancer Res. 2011; 71:1742-1751.

34. Zhang X, Cheng SL, Bian K, Wang L, Zhang X, Yan B, Jia LT, Zhao J, Gammoh N, Yang AG, Zhang R. MicroRNA-26a promotes anoikis in human hepatocellular carcinoma cells by targeting alpha5 integrin. Oncotarget. 2015; 6:2277-2289. https://doi.org/10.18632/oncotarget.2956.

35. Rivera J, Lozano ML, Navarro-Nunez L, Vicente V. Platelet receptors and signaling in the dynamics of thrombus formation. Haematologica. 2009; 94:700-711.

36. Jain S, Harris J, Ware J. Platelets: linking hemostasis and cancer. Arterioscler Thromb Vasc Biol. 2010; 30:2362-2367.

37. Zhao F, Li L, Guan L, Yang H, Wu C, Liu Y. Roles for GP IIb/IIIa and alphavbeta3 integrins in MDA-MB-231 cell invasion and shear flow-induced cancer cell mechanotransduction. Cancer Lett. 2014; 344:62-73.

38. Han C, Yu L, Liu X, Yu T, Qin W, Liao X, Liu Z, Lu S, Chen Z, Su H, Zhu G, Qin X, Gui Y, et al. ATXN7 gene variants and expression predict post-operative clinical outcomes in hepatitis B virus-related hepatocellular carcinoma. Cell Physiol Biochemy. 2016; 39:2427-2438.


Creative Commons License All site content, except where otherwise noted, is licensed under a Creative Commons Attribution 4.0 License.
PII: 20161